Could We Fix Just the One Letter?
COMPUTATIONAL Instead of replacing the entire STRC gene (5325 bp), what if we could correct just the single mutated base? There are three types of gene editing tools. I checked each one against Michael's specific variant.
Michael's mutation: one wrong letter
Healthy: ...AATTTACAGTG...
Michael: ...AATTTCCAGTG...
We need to change C back to A. This is called a C>A transversion.
CBE (Cytosine Base Editor)
What it does:
C → T only
We need C→A. CBE can only do C→T.
Cannot fix this variant
ABE (Adenine Base Editor)
What it does:
A → G only
Wrong direction entirely. Irrelevant here.
Cannot fix this variant
Prime Editor
What it does:
any → any (all 12 substitutions)
C→A included. Needs a PAM site nearby.
CAN fix this variant
PAM site found: 4 bp from variant
Prime editing requires a "landing pad" (PAM site, NGG sequence) near the target. I downloaded the genomic sequence from Ensembl REST API and searched for NGG motifs within 15 bp of the variant.
chr15:43600521-43600581 (GRCh38)
CCCAGCTCCCCACCTGCTATGGTGCCCCAATTT[C]AGTGAAGATCTCAGG
..........................PAM↑....↑variant
..........................4bp apart
How I found this: Ensembl API returns the genomic sequence. I searched for "CC" (reverse complement of NGG PAM) within 15bp of position 43600551. Found one at 4bp distance. This is within the optimal prime editing window (0-13bp).
Reality check: Prime editing has not been tested in inner ear hair cells in vivo. Delivering the prime editor + guide RNA to outer hair cells deep in the cochlea is an unsolved challenge. But this analysis confirms that Michael's specific variant is technically targetable. If delivery is solved (an active area of research), this mutation can be corrected at the DNA level.